Recipes for `slide_snake`

Recipes are the core configuration system in slide_snake that define how your spatial RNA-seq data should be processed. They specify everything from barcode extraction strategies to alignment parameters, making the pipeline modular and allowing for easy comparison of different preprocessing approaches.

Overview

Recipes solve a key challenge in spatial RNA-seq analysis: different platforms and experimental setups require different processing strategies. Rather than creating separate pipelines, slide_snake uses recipes to standardize and modularize these differences.

Key Benefits

Modular Processing: Mix and match different barcode extraction, alignment, and filtering strategies
Benchmarking: Run multiple recipes on the same sample to compare approaches
Reproducibility: Standardized parameter sets ensure consistent results
Extensibility: Easy to add new platforms or custom processing strategies

Recipe Configuration

Key Parameters:

Cell barcode: 16bp at start of R1
UMI: 12bp following barcode
Standard 10x whitelist
Compatible with Space Ranger outputs

Curio Seeker/SlideSeq

Seeker Recipe Strategies

Seeker data presents unique challenges due to barcode synthesis artifacts (indels, low quality). Multiple strategies are available:

Recipe	Strategy	Best For
`seeker`	Fixed position extraction	High-quality barcode synthesis
`seeker_hardTrim`	Hard trim + STARsolo correction	Moderate quality issues
`seeker_MatchLinker`	Adapter-based extraction	Recommended - handles indels
`seeker_MatchLinker_total`	Adapter-based + total RNA	Degraded samples

Adapter-Based Processing (seeker_MatchLinker):

Searches for adapter sequence with 2 mismatches allowed
Extracts barcodes/UMIs relative to adapter position
Handles synthesis indels effectively
Best performance with Curio Seeker data

StereoSeq/STOmics (BGI)

STOmics Recipes

Recipe	Description	Notes
`stomics`	Standard STOmics processing	For DNB arrays
`stomics_total`	Total RNA alignment	Enhanced multi-mapper handling
`stomics_std_rRNA-bwa`	Standard + rRNA filtering	BWA-based filtering
`stomics_std_ribodetector`	Standard + rRNA filtering	ML-based filtering

Requirements:

Need DNB barcode whitelist (use ST_BarcodeMap)
High-density array format
Standard Illumina-style processing

DBIT-seq

DBIT Recipes

Recipe	Description	Features
`dbit-pretrim`	Pre-trim adapter sequences	Handles DBIT adapter structure
`dbit-pretrim_total`	Pre-trim + total RNA	For total RNA libraries

Characteristics:

Spatial barcodes in deterministic grid pattern
Custom adapter trimming required
Works with 10x100 or 50x50 grids

DecoderSeq

DecoderSeq Recipes

Recipe	Description	Reference
`decoder`	Standard DecoderSeq processing	Cao et al, Nat Biotechnol 2024
`decoder_total`	Total RNA alignment	Enhanced gene detection

Features:

Single-cell resolution spatial transcriptomics
Compatible with standard Illumina processing
High spatial resolution

Technology Specifications

d Configuration

rRNA Filtering Options

BWA-based filtering:

Fast, reference-based
Requires rRNA BWA index
Good for known rRNA sequences

RiboDetector:

Machine learning-based
No reference required
Better for novel rRNA detection

Total RNA vs Standard

Standard: Optimized for mRNA (unique alignments)
Total RNA: Allows multi-mappers, better for repetitive regions

Quality Control Integration

All recipes automatically include:

FastQC on raw and processed reads
Alignment statistics
Barcode correction metrics
UMI deduplication stats

This comprehensive recipe system allows slide_snake to handle the diverse landscape of spatial RNA-seq technologies while maintaining consistency and reproducibility.

Field	Description	Required	Example for `seeker_internalTrim`
`R1_finalLength`	Minimum final length of Read1 after trimming.	both	32
`fwd_primer`	Forward primer sequence - next to the barcode; used for stranding reads.	ont	`CTACACGACGCTCTTCCGATCT`
`rev_primer`	Reverse primer sequence - away from the barcode; used for stranding reads (TSO/2nd strand primer for most methods).	ont	`AAGCAGTGGTATCAACGCAGAG`
`BC_adapter`	Adapter sequence for barcode extraction; include adapter for each BC if there are multiple	ont	`TCTTCAGCGTTCCCGAGA TCTTCAGCGTTCCCGAGA`
`BC_start`	Start position of the barcode in the read.	ont	0 26
`BC_length`	Length of the barcode.	ont	8 6
`BC_offset`	Offset for barcode extraction.	ont	0 0
`BC_position`	Position of the barcode relative to BC_adapter (“left” for 5’, or “right” for 3’)	ont	left right
`BC_max_ED`	Maximum edit distance (levenshtein) allowed for barcode matching.	ont	2
`BC_min_ED_diff`	Minimum difference in edit distance (levenshtein) between 1st and 2nd closest matches	ont	1
`BC_concat`	Should barcodes be combined for correction? (eg, True for SlideSeq, False for combinatorial indexing)	ont	True
`UMI_adapter`	Adapter sequence for finding the UMI.	ont	`TCTTCAGCGTTCCCGAGA`
`UMI_start`	Start position of the UMI in the read (if there is no adapter)	ont	0
`UMI_length`	Length of the UMI.	both	7
`UMI_offset`	Offset for UMI extraction, relative to the adapter.	ont	14
`UMI_position`	Position of the UMI relative to UMI_adapter (“left” for 5’, or “right” for 3’)	ont	right
`internal_adapter`	Internal adapter sequence for trimming.	ilmn	`TCTTCAGCGTTCCCGAGA`
`STAR_soloType`	Type of `STARsolo` analysis (e.g., “CB_UMI_Simple”).	ilmn	CB_UMI_Simple
`STAR_soloCBmatchWLtype`	Type of whitelist matching for `STARsolo`.	ilmn	1MM_multi
`STAR_soloCB`	Cell barcode configuration for `STARsolo`.	ilmn	–soloCBstart 1 –soloCBlen 14
`STAR_soloUMI`	UMI configuration for `STARsolo`.	ilmn	–soloUMIstart 15 –soloUMIlen 7
`STAR_soloAdapter`	Adapter sequence for `STARsolo` barcode anchoring.	ilmn	[empty]
`STAR_extra`	Additional parameters for `STAR` alignment.	ilmn	–outFilterMultimapNmax 50
`kb_x`	Custom technology string for `kb-python`.	ilmn	0,0,14:0,14,21:1,0,0
`kb_extra`	Additional parameters for `kb-python`.	ilmn	[empty]
`featureCounts_extra`	Additional parameters for `featureCounts` quantification.	ilmn	[empty]
`mm2_extra`	Additional parameters for `minimap2` alignment.	ont	–secondary=no
`ultra_extra`	Additional parameters for `ultra`.	ont	–disable_infer

`STARsolo` barcode and UMI specifications

See the STARsolo documentation here for details.

soloCBposition              -
    strings(s)              position of Cell Barcode(s) on the barcode read.
                            Presently only works with --soloType CB_UMI_Complex, and barcodes are assumed to be on Read2.
                            Format for each barcode: startAnchor_startPosition_endAnchor_endPosition
                            start(end)Anchor defines the Anchor Base for the CB: 0: read start; 1: read end; 2: adapter start; 3: adapter end
                            start(end)Position is the 0-based position with of the CB start(end) with respect to the Anchor Base
                            String for different barcodes are separated by space.
                            Example: inDrop (Zilionis et al, Nat. Protocols, 2017):
                            --soloCBposition  0_0_2_-1  3_1_3_8

soloUMIposition             -
    string                  position of the UMI on the barcode read, same as soloCBposition
                            Example: inDrop (Zilionis et al, Nat. Protocols, 2017):
                            --soloCBposition  3_9_3_14

soloAdapterSequence         -
    string:                 adapter sequence to anchor barcodes.

soloAdapterMismatchesNmax   1
    int>0:                  maximum number of mismatches allowed in adapter sequence.

`kallisto` technology speifications

kb_python uses ngs-tools for tech specifications - link

name            description                            on-list    barcode                    umi        cDNA
------------    -----------------------------------    -------    -----------------------    -------    -----------------------
10XV1           10x version 1                          yes        0,0,14                     1,0,10     2,None,None
10XV2           10x version 2                          yes        0,0,16                     0,16,26    1,None,None
10XV3           10x version 3                          yes        0,0,16                     0,16,28    1,None,None
10XV3_ULTIMA    10x version 3 sequenced with Ultima    yes        0,22,38                    0,38,50    0,62,None
BDWTA           BD Rhapsody                            yes        0,0,9 0,21,30 0,43,52      0,52,60    1,None,None
BULK            Bulk (single or paired)                                                                 0,None,None 1,None,None
CELSEQ          CEL-Seq                                           0,0,8                      0,8,12     1,None,None
CELSEQ2         CEL-SEQ version 2                                 0,6,12                     0,0,6      1,None,None
DROPSEQ         DropSeq                                           0,0,12                     0,12,20    1,None,None
INDROPSV1       inDrops version 1                                 0,0,11 0,30,38             0,42,48    1,None,None
INDROPSV2       inDrops version 2                                 1,0,11 1,30,38             1,42,48    0,None,None
INDROPSV3       inDrops version 3                      yes        0,0,8 1,0,8                1,8,14     2,None,None
SCRUBSEQ        SCRB-Seq                                          0,0,6                      0,6,16     1,None,None
SMARTSEQ2       Smart-seq2  (single or paired)                                                          0,None,None 1,None,None
SMARTSEQ3       Smart-seq3                                                                   0,11,19    0,11,None 1,None,None
SPLIT-SEQ       SPLiT-seq                                         1,10,18 1,48,56 1,78,86    1,0,10     0,None,None
STORMSEQ        STORM-seq                                                                    1,0,8      0,None,None 1,14,None
SURECELL        SureCell for ddSEQ                                0,0,6 0,21,27 0,42,48      0,51,59    1,None,None
Visium          10x Visium                             yes        0,0,16                     0,16,28    1,None,None

Info on custom technology string from kb-python preprint:

The custom technology string (supplied to -x) contains the format barcode:UMI:DNA,
representing the locational information of the barcode, UMI, and the DNA (where DNA is the
biological read to be mapped):

-x a,b,c:d,e,f:g,h,i
- a: barcode file number, b: barcode start position, c: barcode end position
- d: UMI file number, e: UMI start position, f: UMI end position
- g: DNA file number, h: DNA start position, i: DNA end position

Important notes: File numbers and positions are zero-indexed. If no specific end position
exists (i.e. the end position is the very end of the read), the end position should be set to 0. If
cell barcodes and/or UMIs are not supported by the technology, the barcode and/or UMI field
can be set to -1,0,0.

Thus, for 10xv3:
-x 0,0,16:0,16,28:1,0,0

Sequences can be stitched together by specifying multiple locations; for example, a
SPLiT-seq45 assay, which contains three separate unlinked barcodes, each of length 8, and a
UMI of length 10 in the second file and the DNA in the first file would look as follows:

-x 1,10,18,1,48,56,1,78,86:1,0,10:0,0,0

Final note about multiple locations: If the paired-end read mapping option is enabled, exactly
two DNA locations should be specified (for the first and second read in the pair).
If a technology does not fit into this format (e.g. due to barcodes or UMIs of variable lengths
and positions), preprocessing of the FASTQ file should be performed beforehand to reformat
the reads into a structure that can be handled by this format.

Recipes:

SlideSeq/Seeker (Curio)

[manuscript link]() [Curio website](https://curiobioscience.com/)

Because of read quality issues (indels, low Q scores, etc.) in the SlideSeq barcode read, I have added a few custom strategies for handling these data:

seeker - No hard trimming, and use the base positions for barcode/UMI (Note, this recipe doesn’t work well w/ Curio Seeker b/c of in/del issues w/ the barcode synthesis)
seeker_hardTrim - Hard trim the adapter read positions in R1, and use the best barcode correction algorithms in STARsolo
seeker_MatchLinker - Match the adapter sequence on R1 (w/ 2 mismatches allowed) and infer barcodes/UMIs from that position (Note best performer w/ Curio data)
seeker_MatchLinker_total - Same as seeker_noTrimMatchLinker, but with additional STAR parameters for total RNAseq alignment (more multimappers, looser alignment)
seeker_std_rRNA-bwa - Standard alignment with rRNA filtering using BWA
seeker_std_ribodetector - Standard alignment with rRNA filtering using RiboDetector
seeker_std_total_rRNA-bwa - Total RNA alignment with rRNA filtering using BWA
seeker_std_total_ribodetector - Total RNA alignment with rRNA filtering using RiboDetector

StereoSeq/STOmics (BGI)

stomics - Standard alignment for StereoSeq/STOmics (BGI) data
stomics_total - Total RNA alignment for StereoSeq/STOmics (BGI) data
stomics_std_rRNA-bwa - Standard alignment with rRNA filtering using BWA
stomics_std_ribodetector - Standard alignment with rRNA filtering using RiboDetector
stomics_std_total_rRNA-bwa - Total RNA alignment with rRNA filtering using BWA
stomics_std_total_ribodetector - Total RNA alignment with rRNA filtering using RiboDetector

Visium (10x Genomics)

visium - Standard alignment for Visium (10x Genomics) data
visium_total - Total RNA alignment for Visium (10x Genomics) data
visium_std_rRNA-bwa - Standard alignment with rRNA filtering using BWA
visium_std_ribodetector - Standard alignment with rRNA filtering using RiboDetector
visium_std_total_rRNA-bwa - Total RNA alignment with rRNA filtering using BWA
visium_std_total_ribodetector - Total RNA alignment with rRNA filtering using RiboDetector

DecoderSeq (Cao et al, Nat Biotechnol, 2024)

[manuscript link](https://www.nature.com/articles/s41587-023-02086-y)

decoder - Standard alignment for DecoderSeq data
decoder_total - Total RNA alignment for DecoderSeq data

Recipes for slide_snake